Skip to main content

Table 1 PCR premiers for P15, DNMT1, DNMT3A, and DNMT3B mRNA

From: Reactivating aberrantly hypermethylated p15 gene in leukemic T cells by a phenylhexyl isothiocyanate mediated inter-active mechanism on DNA and chromatin

  sequence (5'-3') extent (bp) anneal temperature (°C)
actin1 F:gtggggcgccccaggcacca 517 Variable
  R:ctccttaatgtcacgcacgatttc   
actin2 F:ctacaatgagctgcgtgtggc 271 Variable
  R:caggtccagacgcaggatggc   
p15 F:tgggggcggcagcgatgag 451 56
  R:aggtgggtgggggtgggaaat   
DNMT1 F:accatcacatctcattttgc 238 56
  R:ggtttgacttcggagtctct   
DNMT3A F:cacacagaagcatatccaggagtg 551 55
  R:agtggactgggaaaccaaataccc   
DNMT3B F:aatgtgaatccagccaggaaaggc 190 55
  R:actggattacactccaggaaccgt   
  1. F: Forward primer R: Reverse primer
  2. cDNA was amplified using specific primer for, DNMT1