Skip to main content

Table 1 Primer sequences used in this study

From: Novel human polyomaviruses, Merkel cell polyomavirus and human polyomavirus 9, in Japanese chronic lymphocytic leukemia cases

Real-time PCR analysis
Target gene Forward (5′ → 3′) Reverse (5′ → 3′) Probe (5′ → 3′)
MCPyV ST GCAAAAAAACTGTCTGACGTGG CCACCAGTCAAAACTTTCCCA FAM-TATCAGTGCTTTATTCTTTGGTTTGGATTTCCTCCT- TAMRA
HPyV9 VP1 TGCTGTTGATATTGTTGGAATTCA AACAACCCGTTTCCTTAGAGTTACA FAM-CTGGAGAGGCCTACCT-NFQ-MGB
Human RNase P AGATTTGGACCTGCGAGCG GAGCGGCTGTCTCCACAAGT FAM-TTCTGACCTGAAGGCTCTGCGCG-TAMRA
PCR analysis
Target gene (positions) Forward (5′ → 3′) Reverse (5′ → 3′)  
MCPyV LT (1867–2221) AGCCCCCTTACAAATTACTGCAAG* AGCATTTCTGTCCTGGTCATTTC*  
MCPyV ST-LT (183–828) GCATATAGACAAGATGGATTTA ATAACCTTTCTTTGATATTTTGC  
MCPyV ST-LT (571–1157) TTGTCTCGCCAGCATTGTAG GGATCCAGAGGATGAGGTGGGTTC  
  1. *Primers for mutational analysis.
  2. Primers for sequence analysis of the ST-LT genes.