Skip to main content

Table 1 List of primers used for PCR analysis

From: Alternative expression of TCRζ related genes in patients with chronic myeloid leukemia

Primer Sequence(5′--3′) Association number Product size
TCRζ3-UTR-f CAGCCAGGGGATTTCCACCACTCAAAG NM_000734.3 906 bp/344 bp
TCRζ3-UTR-r CCCTAGTACATTGACGGGTTTTTCCTG
ASF/SF-2-f TCTCTGGACTGCCTCCAAGT NM_006924.4 473 bp/273 bp
ASF/SF-2-r GGCTTCTGCTACGACTACGG
TCRζ-f GCCAGAACCAGCTCTATAAC NM_009743.3 166 bp
TCRζ-r TAGGCCTCCGCC ATCTTATC
FcεRIγ-f GAGCCTCAGCTCTGCTATATCC NM_004106.1 172 bp
FcεRIγ-r TCTCGTAAGTCTCCTG GTGCC
ZAP-70-f GTTGACTCATCCTCAGAGACGAAT NM_001079.3 183 bp
ZAP-70-r AGGTTATCGCGCTTCAGGAA
β2M-f TACACTGAATTCCACCCCCAC J00105 144 bp
β2M-r CACTCAATCCAAATGCGGCA