Skip to main content

Table 1 Sequences and binding affinity of selected aptamers

From: Developing aptamer probes for acute myelogenous leukemia detection and surface protein biomarker discovery

Aptamers Kd (nM) Confidence interval (nM) (95%) Aptamer sequences*
JH6 2.77 0.69-4.85 5′-GTACGCCGCAAGACGAGTTGTGTATAAGCCGGC-3′
JH19 7.57 4.13-11.02 5′-AGGTGTGACTCGATCTGTGGGGGTT GGGGGGTGGTTTTTCGGAA-3′
K19 12.37 7.79-16.94 5′-AAGGGGTT GGGTGGGTTT ATACAAATTA ATTAATATTGTATGGTATATTT-3′
  1. *All aptamers have two short sequences (5′GACGCTTACTCAGGTGTGACTCG3′ and 5′CGAAGGACGCAGATGAAGTCTC3′) attached to the 5′ and 3′ ends, respectively, of the aptamer sequences shown above. The short sequences at 5′ and 3′ ends were used for PCR amplification.