Skip to main content

Table 2 Primers for RT-PCR

From: Lung tumor exosomes induce a pro-inflammatory phenotype in mesenchymal stem cells via NFκB-TLR signaling pathway

Gene Forward primer and reverse primer (5'–3')
ALP CCACGTCTTCACATTTGGTG; AGACTGCGCCTGGTAGTTGT
RUNX2 TGTCATGGCGGGTAACGAT; AAGACGGTTATGGTCAAGGTGAA
OCN GGCGCTACCTGTATCAATGG; GTGGTCAGCCAACTCGTCA
PPAR γ CCTATTGACCCAGAAAGCGATT; CATTACGGAGAGATCCACGGA
LPL ACAAGAGAGAACCAGACTCCAA; AGGGTAGTTAAACTCCTCCTCC
C/EBPβ CTTCAGCCCGTACCTGGAG; GGAGAGGAAGTCGTGGTGC
IL-6 ACTCACCTCTTCAGAACGAATTG;CCATCTTTGGAAGGTTCAGGTTG
IL-8 ACTCCAAACCTTTCCACCCC; TTCTCAGCCCTCTTCAAAAACTTC
MCP-1 CAGCCAGATGCAATCAATGCC; TGGAATCCTGAACCCACTTCT
IL-1β AGCTACGAATCTCCGACCAC; CGTTATCCCATGTGTCGAAGAA
TNF-α CCTCTCTCTAATCAGCCCTCTG; GAGGACCTGGGAGTAGATGAG
IFN-α GCCTCGCCCTTTGCTTTACT; CTGTGGGTCTCAGGGAGATCA
IFN-β GCTTGGATTCCTACAAAGAAGCA;ATAGATGGTCAATGCGGCGTC
IFN-γ TCGGTAACTGACTTGAATGTCCA; TCGCTTCCCTGTTTTAGCTGC
ACTA2 CGATGCTCCCAGGGCTGTTT; TTCGTCACCCACGTAGCTGTCTTT
TLR1 CCACGTTCCTAAAGACCTATCCC; CCAAGTGCTTGAGGTTCACAG
TLR2 ATCCTCCAATCAGGCTTCTCT; GGACAGGTCAAGGCTTTTTACA
TLR3 TTGCCTTGTATCTACTTTTGGG; TCAACACTGTTATGTTTGTGGGT
TLR4 AGACCTGTCCCTGAACCCTAT; CGATGGACTTCTAAACCAGCCA
TLR5 TCCCTGAACTCACGAGTCTTT; GGTTGTCAAGTCCGTAAAATGC
TLR6 TGAATGCAAAAACCCTTCACC; CCAAGTCGTTTCTATGTGGTTGA
TLR7 CACATACCAGACATCTCCCC; CCCAGTGGAATAGGTACACAGTT
TLR8 ATGTTCCTTCAGTCGTCAATGC; TTGCTGCACTCTGCAATAACT
TLR9 CTGCCACATGACCATCGAG; GGACAGGGATATGAGGGATTTGG
TLR10 GGTTCTTTTGCGTGATGGAATC; GTCGTCCCAGAGTAAATCAAC
GAPDH GGTCACCAGGGCTGCTTTTA; GGATCTCGCTCCTGGAAGATG