Skip to main content

Table 1 Sequence of primers used in the paper

From: Low-level expression of HER2 and CK19 in normal peripheral blood mononuclear cells: relevance for detection of circulating tumor cells

Primer/Probe Sequence
Her-2 Forward Primer 5' CCCAACCAGGCGCAGAT 3'
Her-2 Reverse Primer 5' AGGGATCCAGATGCCCTTGTA 3'
Her-2 Taqman Probe 5' 6FAM-CGCCAGATCCAAGCACCTTCACCTT-TAMRA 3'
CK19 Forward Primer 5' CCGCGACTACAGCCACTACTACAC 3'
CK19 Reverse Primer 5' GAGCCTGTTCCGTCTCAAA 3'
CK19 FAM Beacon Probe 5' FAM-CGTGGTGCCACCATTGAGAACTCCAGGACCACG-BHQ1 3'