Skip to main content

Table 1 Primer Sequences Used for Real-time Reverse Transcription Polymerase Chain Reaction.

From: Mitochondrial and endoplasmic reticulum stress pathways cooperate in zearalenone-induced apoptosis of human leukemic cells

Gene Sequences (5'-3') GenBank accession number
GRP78 Forward: GCCTGTATTTCTAGACCTGCC
Reverse: TTCATCTTGCCAGCCAGTTG
NM_005347.3
CRT Forward: AAATGAGAAGAGCCCCGTTCTTCCT
Reverse: AAGCCACAGGCCTGAGATTTCATCTG
NM_004343.3
ERp29 Forward: CCTGAAGATCATGGGGAAGA
Reverse: TTCTGGAAGGCAGTCAGGAT
NM_001034025.1
GAPDH Forward: GAAGGTGAAGGTCGGAGTC
Reverse: GAAGATGGTGATGGGATTTC
NM_002046.3