Open Access

High applicability of ASO-RQPCR for detection of minimal residual disease in multiple myeloma by entirely patient-specific primers/probes

  • Yinlei Bai1,
  • Kwan Yeung Wong1,
  • Tsz Kin Fung1 and
  • Chor Sang Chim1Email author
Journal of Hematology & Oncology20169:107

https://doi.org/10.1186/s13045-016-0336-4

Received: 3 September 2016

Accepted: 4 October 2016

Published: 11 October 2016

Abstract

Allele-specific oligonucleotide real-time quantitative PCR (ASO-RQPCR) is a standardized technique for detection and monitoring of minimal residual disease (MRD) in acute lymphoblastic leukemia (ALL) but not multiple myeloma (MM) due to a low applicability inherent with presence of somatic hypermutation. Herein, by a staged PCR approach and sequencing, clonality and tumor-specific complementarity-determining region 3 (CDR3) sequence were identified in 13/13 MM by sequential PCR of IgH VDJ (n = 10), IgH DJ (n = 2), or IgK VJ (n = 1). Using consensus primers/probes conventionally employed in ALL, ASO-RQPCR worked in three (23.1 %) cases only. Conversely, using entirely patient-specific primers/probes, ASO-RQPCR was applicable in eight (61.5 %) cases with a sensitivity of 5 × 10−4–10−5. Moreover, using standard curves constructed by serial dilution of plasmids cloned with patient-specific CDR3, ASO-RQPCR was successful in 12 (92.3 %) cases with a sensitivity of 10−4–10−5, but not in a case lacking an N region, in which design of a tumor-specific ASO primer was precluded. Finally, in a patient in complete response (CR), further reduction of MRD after autologous stem cell transplantation (ASCT) was demonstrated. In summary, using entirely patient-specific primers/probes, ASO-RQPCR was applicable in >90 % MM patients and enabled detection of dynamic changes of MRD before and after ASCT despite conventional CR.

Keywords

Multiple myelomaMinimal residual diseasePatient-specific ASO-RQPCR

Letter to the editor

Minimal residual disease (MRD) in multiple myeloma (MM) may be studied by allele-specific oligonucleotide real-time quantitative PCR (ASO-RQPCR), first applied in acute lymphoblastic leukemia (ALL) using patient-specific ASO forward primers derived from complementarity-determining region 3 (CDR3) sequences of immunoglobulin (Ig) genes [1], combined with consensus reverse germline primers and TaqMan probes in the JH region [2]. While applicable in >90 % ALL [3], the consensus primers/probes are only applicable in 42–75 % MM due to somatic hypermutations [4, 5].

Herein, in 13 consecutive MM (Additional file 1: Table S1), clonality and sequence of CDR3 were identified in diagnostic BM of all 13 (100 %) cases by a staged PCR approach, involving sequential PCR of IgH VDJ, IgH DJ, and IgK VJ rearrangements (Additional file 2: Figure S1; Table S2), superior to studies using BIOMED-2 multiplex PCR [4, 5]. Clonality was identified in three (23.1 %) cases by FR3 IgH VDJ PCR, seven (53.8 %) by FR1 IgH VDJ PCR, two (15.4 %) by IgH DJ PCR, and one (7.7 %) by IgK VJ PCR. Similar to previous MM studies [57], VH1, VH3, and VH4 families were mostly used (12~19 %, 47~63 %, and 16~20 %, respectively) (Additional file 2: Table S3).

ASO-RQPCR was first performed using ASO forward primers and consensus primers/probes, according to the EuroMRD guidelines (Additional file 2: Figure S2; Table S2) [2, 8, 9]. By standard curves serially diluted from diagnostic BM, ASO-RQPCR was applicable in only three (23.1 %) cases, with a sensitivity of 5 × 10−4–10–4 and a quantitative range (QR) of 10−3–10−4 (Table 1), suggestive of MRD quantification in follow-up samples with one myeloma cell in a background of 104 normal cells [10]. Causes of failures in other cases included absence of amplification (n = 5) or non-specific amplification in normal control (n = 1) during preliminary qualitative PCR, suboptimal QR of 10−2 (n = 3), or shortage of diagnostic BM for standard curve (n = 1).
Table 1

Performance of RQPCR by consensus germline or entirely patient-specific primers/probes

Cases

Consensus germline primers/probes

Patient-specific primers/probes

Diagnostic marrow DNA as standards

Diagnostic marrow DNA as standards

CDR3-cloned plasmid as standards

Sensitivity

QR

R 2

Slope

Sensitivity

QR

R 2

Slope

Sensitivity

QR

R 2

Slope

Dx53

N/A

10−2

N/A

N/A

10−5

10−4

0.996

−3.30

10−5

10−4

0.992

−3.44

M3

ND

ND

ND

ND

5 × 10−4

5 × 10−4

0.989

−3.48

10−4

10−4

0.997

−3.54

M8

10−4

5 × 10−4

0.985

−3.38

10−4

10−3

0.999

−3.46

10−4

5 × 10−4

0.999

−3.61

M4

ND

ND

ND

ND

10−4

10−3

0.984

−3.60

10−5

10−3

0.999

−3.54

Dx31

ND

ND

ND

ND

10−4

5 × 10−4

0.998

−3.45

10−4

10−4

0.998

−3.47

M5

10−4

10−4

0.995

−3.41

5 × 10−4

5 × 10−4

0.995

−3.67

10−5

10−4

0.998

−3.51

M10

N/A

5 × 10−4

N/A

N/A

N/A

5 × 10−4

N/A

N/A

10−4

10−4

0.994

−3.51

Dx49

5 × 10−4

10−3

0.982

−3.37

10−4

10−3

0.986

−3.26

10−4

5 × 10−4

0.999

−3.76

M1

ND

ND

ND

ND

5 × 10−4

10−3

0.986

−3.48

10−4

5 × 10−4

0.998

−3.52

M6

ND

ND

ND

ND

N/A

5 × 10−4

N/A

N/A

10−5

5 × 10−4

0.997

−3.72

M2

N/A

N/A

N/A

N/A

ND

ND

ND

ND

ND

ND

ND

ND

M7

N/A

10−2

N/A

N/A

N/A

10−2

N/A

N/A

10−4

10−3

0.999

−3.56

M9

N/A

10−2

N/A

N/A

N/A

10−2

N/A

N/A

10−4

10−4

0.997

−3.55

Abbreviations: QR quantitative range, R 2 correlation coefficient, N/A not applicable, ND not done due to absence of target band in qualitative PCR or no need (for M2 in patient-specific approach)

To account for a low applicability using consensus primers/probes, a systematic search for sequences mismatches against consensus primers/probes was performed. Sequencing data revealed mismatches in five (50 %) cases against consensus primers, six (50 %) against probes, and two (20 %) against both sites, but not in two IgH cases (M7 and M10) or one IgK case (M9) (Table 2). While a previous MM study also showed a high frequency of mismatches against consensus primers/probes in patients with IgH VDJ rearrangements (herein 80 vs. 75 %), the number of mismatches per case was higher in our study (five vs. three) [11]. Given that mismatches of ≥3 bases would preclude a successful ASO-RQPCR [11], the use of patient-specific primers/probes is inevitable in Chinese MM with profound mismatches than Caucasian patients.
Table 2

Mismatches against consensus germline reverse primers and/or probes

Cases

Mismatches against primers

Mismatches against probes

Primers

Primer binding site sequences

No.

Probes

Probe binding site sequences

No.

Dx53

R-JH6-intron

gcagaGaGGaaGggccctagagt

4

T-JH6

cacggtcaccgtctcctcaggCaagaa

1

M3

R-JH4-intron

cagagAAaaTATCACagagaggttgt

8

T-JH1.2.4.5

ccctggtcaccgtctcctcaggtg

0

M8

R-JH4-intron

cagagCtaaagcaggagagaggttgt

1

T-JH1.2.4.5

ccctggtcaccgtctcctcaggtg

0

M4

R-JH4-intron

cagGAttTaagTaggGgagaCgttgt

6

T-JH1.2.4.5

ccctggtcaccgtctcctcaggtg

0

Dx31

R-JH4-intron

TagaCCCaaagTaggagagaCAttAt

8

T-JH1.2.4.5

Tcctggtcaccgtctcctcaggtg

1

M5

R-JH3-intron

aggcagaaggaaagccatcttac

0

T-JH3

cCagggacaatggtcaccgtctcttca

1

M10

R-JH6-intron

gcagaaaacaaaggccctagagt

0

T-JH6

cacggtcaccgtctcctcaggtaagaa

0

Dx49

R-JH6-intron

?

T-JH6

cacggtcaccgtctcctcaggtaagaT

1

M1

R-JH4-intron

?

T-JH1.2.4.5

cTGt---

≥2

M6

R-JH3-intron

?

T-JH3

caagggacaat---

?

M2

R-JH4-intron

cagagttaaagcaggagagaggttgt

0

T-JH1.2.4.5

ccctggtcGccgtctcctcaggtg

1

M7

R-JH5-intron

agagagggggtggtgaggact

0

T-JH1.2.4.5

ccctggtcaccgtctcctcaggtg

0

M9

R-Jk1

gatcacttcatagacacagggaacag

0

T-Jk1

tggaaatcaaacgtgag

0

Uppercase letters in sequences indicate mismatches. “?” indicates mismatches cannot be identified based on available sequencing data

Therefore, ASO-RQPCR using entirely patient-specific primers/probes was performed (Additional file 2: Figure S2; Table S4). Except one case (M2) amplified by IgH DJ PCR, where the absence of an N region precluded design of a specific ASO primer, patient-specific primers/probes ASO-RQPCR was successful in eight (61.5 %) cases (Table 1).

Moreover, as diagnostic BM was limited, we attempted to construct standard curves by plasmid DNA cloned with patient-specific CDR3, whereby ASO-RQPCR was applicable in all 12 cases, with a sensitivity of ≤10−4 in all 12 (100 %) cases and a QR ≤5 × 10−4 in ten (83.3 %) cases (Table 1). Collectively, using CDR3-cloned plasmid DNA, more cases achieved a sensitivity of ≤10−4 than using diagnostic BM (12 vs. 5 cases: p = 0.0046; Table 1), and applicability was increased from 61.5 to 92.3 %. Moreover, plasmid DNA provides an unlimited supply for standard curve construction in multiple MRD analysis. Furthermore, the use of plasmid DNA is more accurate for cases in which the percentage of plasma cells was not specified in the diagnostic BM.

Finally, in a patient (Dx53) who achieved serological complete response (CR) after four cycles of VTD induction, by ASO-RQPCR with a sensitivity of 10−5 and QR of 10−4, MRD was present in both BM samples on days 120 and 16 prior to autologous stem cell transplantation (ASCT), but turned negative on day 14 after ASCT, testifying further reduction of tumor load below clinical detection limit by ASCT (Additional file 2: Figure S3).

In summary, a high applicability and sensitivity of MRD detection by ASO-RQPCR can be achieved by clonality detection using stepwise PCR approach, mismatch analysis, and hence entirely patient-specific primers/probes in addition to standard curve construction using CDR3-cloned plasmid DNA. Moreover, the use of ASCT in a patient achieving serological CR after induction was justified by further reduction of tumor load illustrated by ASO-RQPCR. Finally, the frequency and intensity of mismatches against consensus primers/probes between different populations warrants further study in an expanded cohort.

Abbreviations

ALL: 

Acute lymphoblastic leukemia

ASCT: 

Autologous stem cell transplantation

ASO-RQPCR: 

Allele-specific oligonucleotide real-time quantitative PCR

CDR: 

Complementarity-determining region

CR: 

Complete response

Ig: 

Immunoglobulin

MM: 

Multiple myeloma

MRD: 

Minimal residual disease

Declarations

Acknowledgements

Not applicable.

Funding

Nil.

Availability of data and materials

Detailed materials and methods and all data are included in this published article and its additional files.

Authors’ contributions

CSC designed the research study. CSC helped in the sample collection and clinical data retrieval. YB and TKF performed the research. CSC, KYW, and YB wrote the paper. All authors analyzed the data and had final approval of the submitted and final versions.

Competing interests

The authors declare that they have no competing interests.

Consent for publication

Not applicable.

Ethics approval and consent to participate

The study was approved by the Institutional Review Board of the University of Hong Kong/Hospital Authority Hong Kong West Cluster (HKU/HA HKW IRB, IRB Reference Number: UW 05-269 T/932) with informed consents.

Open AccessThis article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Authors’ Affiliations

(1)
Department of Medicine, Queen Mary Hospital, The University of Hong Kong

References

  1. Chim JC, Coyle LA, Yaxley JC, Cole-Sinclair MF, Cannell PK, Hoffbrand VA, et al. The use of IgH fingerprinting and ASO-dependent PCR for the investigation of residual disease (MRD) in ALL. Br J Haematol. 1996;92:104–15.View ArticlePubMedGoogle Scholar
  2. Verhagen OJ, Willemse MJ, Breunis WB, Wijkhuijs AJ, Jacobs DC, Joosten SA, et al. Application of germline IGH probes in real-time quantitative PCR for the detection of minimal residual disease in acute lymphoblastic leukemia. Leukemia. 2000;14:1426–35.View ArticlePubMedGoogle Scholar
  3. Bruggemann M, Schrauder A, Raff T, Pfeifer H, Dworzak M, Ottmann OG, et al. Standardized MRD quantification in European ALL trials: proceedings of the Second International Symposium on MRD assessment in Kiel, Germany, 18–20 September 2008. Leukemia. 2010;24:521–35.View ArticlePubMedGoogle Scholar
  4. Sarasquete M, Garcia-Sanz R, Gonzalez D, Martinez J, Mateo G, Martinez P, et al. Minimal residual disease monitoring in multiple myeloma: a comparison between allelic-specific oligonucleotide real-time quantitative polymerase chain reaction and flow cytometry. Haematologica. 2005;90:1365–72.PubMedGoogle Scholar
  5. Puig N, Sarasquete ME, Balanzategui A, Martinez J, Paiva B, Garcia H, et al. Critical evaluation of ASO RQ-PCR for minimal residual disease evaluation in multiple myeloma. A comparative analysis with flow cytometry. Leukemia. 2014;28:391–7.View ArticlePubMedGoogle Scholar
  6. Gonzalez D, van der Burg M, Garcia-Sanz R, Fenton JA, Langerak AW, Gonzalez M, et al. Immunoglobulin gene rearrangements and the pathogenesis of multiple myeloma. Blood. 2007;110:3112–21.View ArticlePubMedGoogle Scholar
  7. Owen RG, Johnson RJ, Rawstron AC, Evans PA, Jack A, Smith GM, et al. Assessment of IgH PCR strategies in multiple myeloma. J Clin Pathol. 1996;49:672–5.View ArticlePubMedPubMed CentralGoogle Scholar
  8. van der Velden VH, Cazzaniga G, Schrauder A, Hancock J, Bader P, Panzer-Grumayer ER, et al. Analysis of minimal residual disease by Ig/TCR gene rearrangements: guidelines for interpretation of real-time quantitative PCR data. Leukemia. 2007;21:604–11.PubMedGoogle Scholar
  9. van der Velden VH, de Bie M, van Wering ER, van Dongen JJ. Immunoglobulin light chain gene rearrangements in precursor-B-acute lymphoblastic leukemia: characteristics and applicability for the detection of minimal residual disease. Haematologica. 2006;91:679–82.PubMedGoogle Scholar
  10. Paiva B, van Dongen JJ, Orfao A. New criteria for response assessment: role of minimal residual disease in multiple myeloma. Blood. 2015;125:3059–68.View ArticlePubMedPubMed CentralGoogle Scholar
  11. Gonzalez D, Gonzalez M, Alonso ME, Lopez-Perez R, Balanzategui A, Chillon MC, et al. Incomplete DJH rearrangements as a novel tumor target for minimal residual disease quantitation in multiple myeloma using real-time PCR. Leukemia. 2003;17:1051–7.View ArticlePubMedGoogle Scholar

Copyright

© The Author(s). 2016

Advertisement